| 29 matches found in 16 documents. Search time: 0.73 seconds. |
|---|
|
Score: 6.00 |
|---|
| Title: Overexpression of Rab16A gene in indica rice variety for generating enhanced salt tolerance .
| | Author: Ganguly M Datta K Roychoudhury A Gayen D Sengupta DN Datta SK | | Journal: Plant Signal Behav Citation: V : 7 P : Year: 2012 Type: Publisher | | Literature: oryza Field: abstract Doc ID: pub22499169 Accession (PMID): 22499169 | | Abstract: We report here the overexpression of Rab16A full length gene ( promoter + ORF ) , from the salt-tolerant indica rice Pokkali , in the salt-susceptible indica rice variety Khitish , via particle bombardment .
Molecular analysis of the transgenics revealed stable integration of the transgene upto T2 generation .
High level of expression of the transgene ( driven by its own stress-inducible promoter ) , as well as the protein , was detectable in the leaves under simulated salinity stress ( 250 mM NaCl , 24 h ) ; the expression level being higher than wild type ( WT ) plants .
The Rab16A transcript also increased gradually with seed maturity , with its maximal accumulation at 30 d after pollination ( DAP ) ie , fully matured seeds , explaining the protective role of Rab16A gene during seed maturation .
Enhanced tolerance to salinity was observed in the plants transformed with Rab16A .
The superior physiological performances of the transgenics under salt treatment were also reflected in lesser shoot or root length inhibition , reduced chlorophyll damages , lesser accumulation of Na ( + ) and reduced loss of K ( + ) , increased proline content as compared with the WT plants .
All these results indicated that the overproduction of RAB16A protein in the transgenics enable them to display enhanced tolerance to salinity stress with improved physiological traits .
Our work demonstrates the profound potential of Group 2 LEA proteins ( to which RAB16A belongs to ) in conferring stress tolerance in crop plants through their genetic manipulation .
| Matching Sentences:
[ Sen. 4, subscore: 2.00 ]: The Rab16A transcript also increased gradually with seed maturity , with its maximal accumulation at 30 d after pollination ( DAP ) ie , fully matured seeds , explaining the protective role of Rab16A gene during seed maturation .
[ Sen. 1, subscore: 1.00 ]: We report here the overexpression of Rab16A full length gene ( promoter + ORF ) , from the salt-tolerant indica rice Pokkali , in the salt-susceptible indica rice variety Khitish , via particle bombardment .
[ Sen. 5, subscore: 1.00 ]: Enhanced tolerance to salinity was observed in the plants transformed with Rab16A .
[ Sen. 7, subscore: 1.00 ]: All these results indicated that the overproduction of RAB16A protein in the transgenics enable them to display enhanced tolerance to salinity stress with improved physiological traits .
[ Sen. 8, subscore: 1.00 ]: Our work demonstrates the profound potential of Group 2 LEA proteins ( to which RAB16A belongs to ) in conferring stress tolerance in crop plants through their genetic manipulation .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 5.00 |
|---|
| Title: Transgenic tobacco plants overexpressing the heterologous lea gene Rab16A from rice during high salt and water deficit display enhanced tolerance to salinity stress .
| | Author: RoyChoudhury A Roy C Sengupta DN | | Journal: Plant Cell Rep Citation: V : 26 P : 1839-59 Year: 2007 Type: MEDLINE | | Literature: oryza Field: abstract Doc ID: pub17554543 Accession (PMID): 17554543 | | Abstract: The full length Rab16A , from the indica rice Pokkali , was introduced into tobacco by Agrobacterium-mediated transformation .
The transgene was stably integrated into the genome and they originated from different lines of integration .
Expression of Rab16A transcript driven by its own promoter ( stress inducible ) in T2 progenies , only when triggered by salinity/ABA/PEG ( Polyethylene glycol ) -mediated dehydration , but not at the constitutive level , led to the stress-induced accumulation of RAB16A protein in the leaves of transgenic plants .
The selected independent transgenic lines showed normal growth , morphology and seed production as the WT plants without any yield penalty under stress conditions .
They exhibited significantly increased tolerance to salinity , sustained growth rates under stress conditions ; with concomitant increased osmolyte production like reducing sugars , proline and higher polyamines .
They also showed delayed development of damage symptoms with better antioxidative machinery and more favorable mineral balance , as reflected by reduced H2O2 levels and lipid peroxidation , lesser chlorophyll loss as well as lesser accumulation of Na+ and greater accumulation of K+ in 200 mM NaCl .
These findings establish the potential role of Rab16A gene in conferring salt tolerance without affecting growth and yield , as well as pointing to the fact that the upstream region of Rab16A behaves as an efficient stress-inducible promoter .
Our result also suggests the considerable potential of Group 2 lea genes as molecular tools for genetic engineering of plants towards stress tolerance .
| Matching Sentences:
[ Sen. 3, subscore: 2.00 ]: Expression of Rab16A transcript driven by its own promoter ( stress inducible ) in T2 progenies , only when triggered by salinity/ABA/PEG ( Polyethylene glycol ) -mediated dehydration , but not at the constitutive level , led to the stress-induced accumulation of RAB16A protein in the leaves of transgenic plants .
[ Sen. 7, subscore: 2.00 ]: These findings establish the potential role of Rab16A gene in conferring salt tolerance without affecting growth and yield , as well as pointing to the fact that the upstream region of Rab16A behaves as an efficient stress-inducible promoter .
[ Sen. 1, subscore: 1.00 ]: The full length Rab16A , from the indica rice Pokkali , was introduced into tobacco by Agrobacterium-mediated transformation .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 3.00 |
|---|
| Title: Glucose modulates the abscisic acid-inducible Rab16A gene in cereal embryos .
| | Author: Toyofuku K Loreti E Vernieri P Alpi A Perata P Yamaguchi J | | Journal: Plant Mol . Biol . Citation: V : 42 ( 3 ) P : 451-60 Year: 2000 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub10798615 Accession (PMID): 10798615 | | Abstract: Glucose effects on the expression of the abscisic acid-inducible Rab16A gene were examined in rice and barley embryos .
Glucose feeding to rice embryos negatively affects the endogenous abscisic acid content and represses the promoter activity of the Rab16A gene .
Glucose repression of the Rab16A gene takes place both at a transcriptional and a post-transcriptional level .
Modulation of the abscisic acid content in rice embryos triggered by glucose did not directly influence the expression of the rice alpha-amylase gene RAmy3D , which is known to be under glucose control .
The possible interaction between the glucose and abscisic acid signaling pathway is discussed . | Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: Glucose effects on the expression of the abscisic acid-inducible Rab16A gene were examined in rice and barley embryos .
[ Sen. 2, subscore: 1.00 ]: Glucose feeding to rice embryos negatively affects the endogenous abscisic acid content and represses the promoter activity of the Rab16A gene .
[ Sen. 3, subscore: 1.00 ]: Glucose repression of the Rab16A gene takes place both at a transcriptional and a post-transcriptional level .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 3.00 |
|---|
| Title: Comparative functional analysis of three abiotic stress-inducible promoters in transgenic rice .
| | Author: Rai M He C Wu R | | Journal: Transgenic Res Citation: V : P : Year: 2009 Type: Publisher | | Literature: oryza Field: abstract Doc ID: pub19357984 Accession (PMID): 19357984 | | Abstract: To identify minimal effective promoters for driving abiotic stress-inducible transgene expression in rice , we selected promoter elements of three stress-responsive genes , viz . rab16A coding for dehydrin , OsABA2 coding for zeaxanthin epoxidase , and a gene coding for a hypothetical protein ( HP1 ) based on the presence of ABA- , salt and drought-responsive cis-acting elements .
These were translationally fused to the gusA reporter gene and introduced into rice to study their effect on heterologous gene expression .
The OsABA2 promoter was found to be the most effective and desirable promoter among the three in terms of driving a low constitutive transgene expression under normal conditions and high induction in response to ABA , salt and drought stress , the highest being a 12-fold induction in response to ABA .
The rab16A and HP1 promoters resulted in high levels of constitutive expression .
While induction of GUS activity was generally two to threefold for all the treatments in roots for both the promoters , induction in leaves was generally insignificant , the exceptions being rab16A in response to continuous salt stress and HP1 in response to water deficit .
It was also observed that the three promoters , in general , resulted in lower constitutive expression , but higher induction in roots as compared to leaves .
| Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: To identify minimal effective promoters for driving abiotic stress-inducible transgene expression in rice , we selected promoter elements of three stress-responsive genes , viz . rab16A coding for dehydrin , OsABA2 coding for zeaxanthin epoxidase , and a gene coding for a hypothetical protein ( HP1 ) based on the presence of ABA- , salt and drought-responsive cis-acting elements .
[ Sen. 4, subscore: 1.00 ]: The rab16A and HP1 promoters resulted in high levels of constitutive expression .
[ Sen. 5, subscore: 1.00 ]: While induction of GUS activity was generally two to threefold for all the treatments in roots for both the promoters , induction in leaves was generally insignificant , the exceptions being rab16A in response to continuous salt stress and HP1 in response to water deficit .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 3.00 |
|---|
| Title: The rab16B promoter of rice contains two distinct abscisic acid-responsive elements .
| | Author: Ono A Izawa T Chua NH Shimamoto K | | Journal: Plant Physiol .
Citation: V : 112 ( 2 ) P : 483-91 Year: 1996 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub8883374 Accession (PMID): 8883374 | | Abstract: To localize abscisic acid ( ABA ) -inducible gene expression of rab16 genes , rab16A promoter was linked to the gusA reporter gene encoding beta-glucuronidase and introduced into rice ( Oryza sativa L ) plants .
The activity of rab16A promoter was induced by ABA and osmotic stresses in various it issues of vegetative and floral organs .
In anthers and embryos , rab16A promoter was active in the absence of ABA .
To elucidate cis-elements of the rab16 promoter that confer ABA-inducible expression , variously modified 40-bp fragments ( -264 to -225 ) of the rab16B promoter were fused to a truncated ( -46 bp ) cauliflower mosaic virus 35S minimal promoter , and their activities in protoplasts were analyzed .
The transient assays revealed that the 40-bp fragment consists of two separate ABA-responsive elements , motif 1 ( AGTACGTGGC ) and motif III ( GCCGCGTGGC ) .
Motif I and motif III are both required for ABA induction ; however , each can substitute for the other .
Further analyses of these motifs indicated that motif III has a distinct DNA sequence specificity as an ABA-responsive element from motif I , suggesting that the two motifs interact with different transcription factors in vivo . | Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: To localize abscisic acid ( ABA ) -inducible gene expression of rab16 genes , rab16A promoter was linked to the gusA reporter gene encoding beta-glucuronidase and introduced into rice ( Oryza sativa L ) plants .
[ Sen. 2, subscore: 1.00 ]: The activity of rab16A promoter was induced by ABA and osmotic stresses in various it issues of vegetative and floral organs .
[ Sen. 3, subscore: 1.00 ]: In anthers and embryos , rab16A promoter was active in the absence of ABA .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 2.00 |
|---|
| Title: A rice bZIP protein , designated OSBZ8 , is rapidly induced by abscisic acid .
| | Author: Nakagawa H Ohmiya K Hattori T | | Journal: Plant J Citation: V : 9 ( 2 ) P : 217-27 Year: 1996 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub8820608 Accession (PMID): 8820608 | | Abstract: A cDNA that encoded a bZIP protein , designated OSBZ8 , was isolated from a rice embryo cDNA library by use of degenerate oligonucleotide probes that corresponded to the amino acid sequences conserved among the basic regions of plant G-box-binding factor-type bZIP proteins ( GBF ) .
OSBZ8 was shown to have structural features typical of the GBF-type bZIP proteins and to bind to G-box and G-box-like sequences that include ABA-responsive elements ( ABREs ) which have been functionally identified in the promoters of ABA-inducible genes , such as Em , Osem and Rab16 .
The accumulation of OSBZ8 mRNA was induced by treatment with ABA of imbibed mature rice embryos , of young plant it issues and of suspension-cultured cells .
The accumulation of OSBZ8 mRNA in response to ABA preceded that of Osem and Rab16A mRNAs and was not inhibited by an inhibitor of protein synthesis , cycloheximide .
By contrast , the induction of Osem and Rab16A was partially inhibited and almost completely inhibited , respectively , by cycloheximide .
These results strongly suggest that OSBZ8 might be involved in the regulation of transcription by ABA in rice . | Matching Sentences:
[ Sen. 4, subscore: 1.00 ]: The accumulation of OSBZ8 mRNA in response to ABA preceded that of Osem and Rab16A mRNAs and was not inhibited by an inhibitor of protein synthesis , cycloheximide .
[ Sen. 5, subscore: 1.00 ]: By contrast , the induction of Osem and Rab16A was partially inhibited and almost completely inhibited , respectively , by cycloheximide .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: A Ca ( 2+ ) -dependent protein kinase that endows rice plants with cold and salt-stress tolerance functions in vascular bundles .
| | Author: Saijo Y Kinoshita N Ishiyama K Hata S Kyozuka J Hayakawa T Nakamura T Shimamoto K Yamaya T Izui K | | Journal: Plant Cell Physiol .
Citation: V : 42 ( 11 ) P : 1228-33 Year: 2001 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub11726707 Accession (PMID): 11726707 | | Abstract: A rice Ca ( 2+ ) -dependent protein kinase , OsCDPK7 , is a positive regulator commonly involved in the tolerance to cold and salt/drought .
We carried out in situ detection of the transcript and immunolocalization of the protein .
In the wild-type rice plants under both stress conditions , OsCDPK7 was expressed predominantly in vascular it issues of crowns and roots , vascular bundles and central cylinder , respectively , where water stress occurs most severely .
This enzyme was also expressed in the peripheral cylinder of crown vascular bundles and root sclerenchyma .
Similar localization patterns with stronger signals were observed in stress-tolerant OsCDPK7 over-expressing transformants with the cauliflower mosaic virus 35S promoter .
The transcript of a putative target gene of the OsCDPK7 signaling pathway , rab16A , was also detected essentially in the same it issues upon salt stress , suggesting that the OsCDPK7 pathway operates predominantly in these regions .
We propose that the use of the 35S promoter fortuitously strengthened the localized expression of OsCDPK7 , resulting in enhancement of the stress signaling in the inherently operating regions leading to improved stress tolerance . | Matching Sentences:
[ Sen. 6, subscore: 1.00 ]: The transcript of a putative target gene of the OsCDPK7 signaling pathway , rab16A , was also detected essentially in the same it issues upon salt stress , suggesting that the OsCDPK7 pathway operates predominantly in these regions .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: The slender rice mutant , with constitutively activated gibberellin signal transduction , has enhanced capacity for abscisic acid level .
| | Author: Ikeda A Sonoda Y Vernieri P Perata P Hirochika H Yamaguchi J | | Journal: Plant Cell Physiol .
Citation: V : 43 ( 9 ) P : 974-9 Year: 2002 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub12354914 Accession (PMID): 12354914 | | Abstract: The slender rice ( slr1-1 ) mutant , carrying a lethal and recessive single mutation , has a constitutive gibberellin ( GA ) -response phenotype and behaves as if it were saturated with GAs [ Ikeda et al ( 2001 ) Plant Cell 13 , 999 ] .
The SLR1 gene , with sequence homology to members of the plant-specific GRAS gene family , is a mediator of the GA signal transduction process .
In the slender rice , GA-inducible alpha-amylase was produced from the aleurone layer without applying GA .
GA-independent alpha-amylase production in the mutant was inhibited by applying abscisic acid ( ABA ) .
Shoot elongation in the mutant was also suppressed by ABA , indicating that the slender rice responds normally to ABA .
Interestingly , shoot ABA content was 10-fold higher in the mutant than in the wild type , while there was no difference in root ABA content .
Expression of the Rab16A gene , which is known to be ABA inducible , was about 10-fold higher in shoots of the mutant than in those of the wild type .
These results indicate that constitutive activation of the GA signal transduction pathway by the slr1-1 mutation promotes the endogenous ABA level . | Matching Sentences:
[ Sen. 7, subscore: 1.00 ]: Expression of the Rab16A gene , which is known to be ABA inducible , was about 10-fold higher in shoots of the mutant than in those of the wild type .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: Expression of a calcineurin gene improves salt stress tolerance in transgenic rice .
| | Author: Ma X Qian Q Zhu D | | Journal: Plant Mol . Biol . Citation: V : 58 ( 4 ) P : 483-95 Year: 2005 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub16021334 Accession (PMID): 16021334 | | Abstract: Calcineurin is a Ca2+- and calmodulin-dependent serine/threonine phosphatase and has multiple functions in animal cells including regulating ionic homeostasis .
We generated transgenic rice plants that not only expressed a truncated form of the catalytic subunit of mouse calcineurin , but also were able to grow and fertilize normally in the field .
Notably , the expression of the mouse calcineurin gene in rice resulted in its higher salt stress tolerance than the non-transgenic rice .
Physiological studies have indicated that the root growth of transgenic plants was less inhibited than the shoot growth , and that less Na+ was accumulated in the roots of transgenic plants after a prolonged period of salt stress .
These findings imply that the heterologous calcineurin plays a significant role in maintaining ionic homeostasis and the integrity of plant roots when exposed to salt .
In addition , the calcineurin gene expression in the stems of transgenic plants correlated with the increased expression of the Rab16A gene that encodes a group 2-type late-embryogenesis-abundant ( LEA ) protein .
Altogether our findings provide the first genetic and physiological evidence that expression of the mouse calcineurin protein functionally improves the salt stress tolerance of rice partly by limiting Na+ accumulation in the roots . | Matching Sentences:
[ Sen. 6, subscore: 1.00 ]: In addition , the calcineurin gene expression in the stems of transgenic plants correlated with the increased expression of the Rab16A gene that encodes a group 2-type late-embryogenesis-abundant ( LEA ) protein .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: An ABRE-binding factor , OSBZ8 , is highly expressed in salt tolerant cultivars than in salt sensitive cultivars of indica rice .
| | Author: Mukherjee K Choudhury AR Gupta B Gupta S Sengupta DN .
| | Journal: BMC Plant Biol .
Citation: V : 6 ( ) P : 18 Year: Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub16939657 Accession (PMID): 16939657 | | Abstract: BACKGROUND : The bZIP class Abscisic acid Responsive Element ( ABRE ) -binding factor , OSBZ8 ( 38 . 5 kD ) has been considered to regulate ABA-mediated transcription in the suspension cultured cells of japonica rice .
Still , nothing is known about the expression of OSBZ8 at protein level in vegetative it issue of salt sensitive and salt tolerant rice plants .
In our previous study , Electrophoretic Mobility Shift Assay ( EMSA ) of [ 32P ] ABRE-DNA and nuclear extracts prepared from the lamina of Pokkali rice plants has detected the presence of an ABRE-binding factor .
Northern analysis has also detected salinity stress induced accumulation of transcripts for bZIP class of factor .
Therefore , OSBZ8 was considered to play an important role in the regulation of transcription in the vegetative it issue of rice .
The aim of this study is to find out whether OSBZ8 has any role in regulating the NaCl-stress induced gene expression in vegetative it issue and whether the expression of OSBZ8 factor directly correlates with the stress tolerance of different varieties of indica type rice .
RESULTS : Northern analysis of total RNA from roots and lamina of salt-sensitive M-I-48 and salt-tolerant Nonabokra , when probed with the N-terminal unique region of OSBZ8 ( OSBZ8p , without the highly conserved basic region ) , a transcript of 1 . 3 kb hybridized and its level was much higher in tolerant cultivar .
EMSA with Em1a , the strongest ABA Responsive Element till reported from the upstream of EmBP1 , and the nuclear extracts from laminar it issue of untreated and salt-treated seedlings of three salt sensitive , one moderately sensitive and two salt tolerant indica rice cultivars showed specific binding of nuclear factor to ABRE element .
Intensity of binding was low and inducible in salt sensitive rice cultivars while high and constitutive in salt tolerant cultivars .
EMSA with 300 bp 5upstream region of Rab16A gene , a well known salt stress and ABA-inducible gene of rice , showed formation of two complexes , again very weak in salt sensitive and strong in salt tolerant rice cultivar .
CONCLUSION : The bZIP factor OSBZ8 was found to be present in the ABRE-DNA : protein complex as shown by the supershift of the complex by the purified antiserum raised against OSBZ8p .
Treatment of the seedlings with NaCl was found to enhance the complex formation , suggesting the regulation of OSBZ8 gene at both transcriptional and post-translational steps .
Comparative EMSA with different varieties of rice suggests a positive correlation with the expression pattern of OSBZ8 and salt tolerance in rice cultivars . | Matching Sentences:
[ Sen. 10, subscore: 1.00 ]: EMSA with 300 bp 5upstream region of Rab16A gene , a well known salt stress and ABA-inducible gene of rice , showed formation of two complexes , again very weak in salt sensitive and strong in salt tolerant rice cultivar .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: Trans-acting factor designated OSBZ8 interacts with both typical abscisic acid responsive elements as well as abscisic acid responsive element-like sequences in the vegetative it issues of indica rice cultivars .
| | Author: Roychoudhury A Gupta B Sengupta DN | | Journal: Plant Cell Rep Citation: V : 27 P : 779-94 Year: 2008 Type: MEDLINE | | Literature: oryza Field: abstract Doc ID: pub18183401 Accession (PMID): 18183401 | | Abstract: Specific cis-acting elements , identified in the stress-regulated promoters , can respond to the changes in the levels of abscisic acid .
Most of our previous works were done with ACGT-containing typical abscisic acid responsive elements ( ABREs ) but not with non-ACGT , GC-rich sequences also present in such promoters .
The current communication shows a comparative analysis performed on the binding of rice nuclear proteins , together with the purified transcription factor OSBZ8 , to the cis-elements in the promoters of Rab16A ( Motif I/Motif II ) , Osem ( Motif A-1/Motif B ) and Em ( 4X ABRE/2X ABRC ) .
Our data show that the extent of binding of nuclear protein from salt-tolerant rice to both typical ABREs and non-ACGT , ABRE-like sequences such as Motif IIa , is much higher than that from salt-sensitive rice and occurs constitutively , ie , even with the protein from unstressed plants .
The complex formation is low and inducible only by salt in the salt-sensitive variety .
While Motif I bind to a single 38 kDa protein , Motif IIa bind to two polypeptides of 38 and 29 kDa .
We also show here that the activation and binding of OSBZ8 to the upstream regions of salt-inducible genes depends on its phosphorylated state .
The novelty of our work is that it shows rice OSBZ8 as the prime factor interacting with both typical ABRE ( s ) and ABRE-like sequences .
To our knowledge , this is also the first report for the detection and identification of Motif IIa ( non-ACGT , coupling element-like ) -binding factor ( s ) from rice and their expression pattern in different rice cultivars .
| Matching Sentences:
[ Sen. 3, subscore: 1.00 ]: The current communication shows a comparative analysis performed on the binding of rice nuclear proteins , together with the purified transcription factor OSBZ8 , to the cis-elements in the promoters of Rab16A ( Motif I/Motif II ) , Osem ( Motif A-1/Motif B ) and Em ( 4X ABRE/2X ABRC ) .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid .
| | Author: Skriver K Olsen FL Rogers JC Mundy J | | Journal: Proc . Natl . Acad . Sci . USA Citation: V : 88 ( 16 ) P : 7266-70 Year: 1991 Type: ARTICLE | | Literature: oryza Field: abstract Doc ID: pub1831269 Accession (PMID): 1831269 | | Abstract: We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid ( ABA ) -responsive rice gene Rab16A and of the gibberellin A3 ( GA3 ) -responsive barley alpha-amylase gene Amy 1/6-4 .
Our approach used transcriptional fusions between their 5 upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene .
A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene .
Transcription from this ABA response element ( GTACGTGGCGC ) was unaffected by GA3 .
A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene .
Transcription from this GA3 response element ( GGCCGATAACAAACTCCGGCC ) was repressed by ABA .
The effect on transcription from both hormone response elements was orientation-independent , indicating that they function as inducible enhancers in their native genes . | Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid ( ABA ) -responsive rice gene Rab16A and of the gibberellin A3 ( GA3 ) -responsive barley alpha-amylase gene Amy 1/6-4 .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: Inducibility of three salinity/abscisic acid-regulated promoters in transgenic rice with gusA reporter gene .
| | Author: Ganguly M Roychoudhury A Sarkar SN Sengupta DN Datta SK Datta K | | Journal: Plant Cell Rep Citation: V : 30 P : 1617-25 Year: 2011 Type: MEDLINE | | Literature: oryza Field: abstract Doc ID: pub21538101 Accession (PMID): 21538101 | | Abstract: The present study evaluates the pattern of stress inducibility of one natural promoter ( from rice Rab16A ) and two synthetically designed promoters , viz . , 4X ABRE ( abscisic acid-responsive element , having four tandem repeats of ABRE ) and 2X ABRC ( abscisic acid-responsive complex , having two tandem repeats of ABRE and two copies of coupling elements ) , in response to varying concentrations of NaCl and abscisic acid ( ABA ) .
Each promoter , independently linked to gusA ( that encodes beta glucuronidase , GUS ) , was introduced into rice ( cv .
Khitish ) through particle bombardment .
The T ( 2 ) progenies showed integration of gusA in their genome .
The accumulation of gusA transcript , driven by each promoter in T ( 2 ) transgenics , increased with increasing salt/ABA concentration , with ABA being the better activator of each promoter .
Induction in GUS expression , driven by different promoters , was noted on exogenous salt/ABA treatments in a concentration-dependent manner .
The maximum induction was observed with 2X ABRC promoter .
All the three promoters could drive stress-inducible GUS expression in both vegetative and floral organs .
However , prominent GUS expression was noted in the whole seed ( both embryo and aleurone layer of endosperm ) only by 2X ABRC , whereas it was localized only in the embryo for the other two promoters .
Thus , our observation characterizes three efficient salinity/ABA-inducible promoters that have the potentiality in crop biotechnology to drive transgene expression for stress tolerance , whenever abiotic stress is encountered .
| Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: The present study evaluates the pattern of stress inducibility of one natural promoter ( from rice Rab16A ) and two synthetically designed promoters , viz . , 4X ABRE ( abscisic acid-responsive element , having four tandem repeats of ABRE ) and 2X ABRC ( abscisic acid-responsive complex , having two tandem repeats of ABRE and two copies of coupling elements ) , in response to varying concentrations of NaCl and abscisic acid ( ABA ) .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: Glucose modulates the abscisic acid-inducible Rab16A gene in cereal embryos .
| | Author: Toyofuku K Loreti E Vernieri P Alpi A Perata P Yamaguchi J | | Journal: Plant Mol . Biol . Citation: V : 42 ( 3 ) P : 451-60 Year: 2000 Type: ARTICLE | | Literature: oryza Field: title Doc ID: pub10798615 Accession (PMID): 10798615 | | Abstract: Glucose effects on the expression of the abscisic acid-inducible Rab16A gene were examined in rice and barley embryos .
Glucose feeding to rice embryos negatively affects the endogenous abscisic acid content and represses the promoter activity of the Rab16A gene .
Glucose repression of the Rab16A gene takes place both at a transcriptional and a post-transcriptional level .
Modulation of the abscisic acid content in rice embryos triggered by glucose did not directly influence the expression of the rice alpha-amylase gene RAmy3D , which is known to be under glucose control .
The possible interaction between the glucose and abscisic acid signaling pathway is discussed . | Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: Glucose modulates the abscisic acid-inducible Rab16A gene in cereal embryos .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: Transgenic tobacco plants overexpressing the heterologous lea gene Rab16A from rice during high salt and water deficit display enhanced tolerance to salinity stress .
| | Author: RoyChoudhury A Roy C Sengupta DN | | Journal: Plant Cell Rep Citation: V : 26 P : 1839-59 Year: 2007 Type: MEDLINE | | Literature: oryza Field: title Doc ID: pub17554543 Accession (PMID): 17554543 | | Abstract: The full length Rab16A , from the indica rice Pokkali , was introduced into tobacco by Agrobacterium-mediated transformation .
The transgene was stably integrated into the genome and they originated from different lines of integration .
Expression of Rab16A transcript driven by its own promoter ( stress inducible ) in T2 progenies , only when triggered by salinity/ABA/PEG ( Polyethylene glycol ) -mediated dehydration , but not at the constitutive level , led to the stress-induced accumulation of RAB16A protein in the leaves of transgenic plants .
The selected independent transgenic lines showed normal growth , morphology and seed production as the WT plants without any yield penalty under stress conditions .
They exhibited significantly increased tolerance to salinity , sustained growth rates under stress conditions ; with concomitant increased osmolyte production like reducing sugars , proline and higher polyamines .
They also showed delayed development of damage symptoms with better antioxidative machinery and more favorable mineral balance , as reflected by reduced H2O2 levels and lipid peroxidation , lesser chlorophyll loss as well as lesser accumulation of Na+ and greater accumulation of K+ in 200 mM NaCl .
These findings establish the potential role of Rab16A gene in conferring salt tolerance without affecting growth and yield , as well as pointing to the fact that the upstream region of Rab16A behaves as an efficient stress-inducible promoter .
Our result also suggests the considerable potential of Group 2 lea genes as molecular tools for genetic engineering of plants towards stress tolerance .
| Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: Transgenic tobacco plants overexpressing the heterologous lea gene Rab16A from rice during high salt and water deficit display enhanced tolerance to salinity stress .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
Score: 1.00 |
|---|
| Title: Overexpression of Rab16A gene in indica rice variety for generating enhanced salt tolerance .
| | Author: Ganguly M Datta K Roychoudhury A Gayen D Sengupta DN Datta SK | | Journal: Plant Signal Behav Citation: V : 7 P : Year: 2012 Type: Publisher | | Literature: oryza Field: title Doc ID: pub22499169 Accession (PMID): 22499169 | | Abstract: We report here the overexpression of Rab16A full length gene ( promoter + ORF ) , from the salt-tolerant indica rice Pokkali , in the salt-susceptible indica rice variety Khitish , via particle bombardment .
Molecular analysis of the transgenics revealed stable integration of the transgene upto T2 generation .
High level of expression of the transgene ( driven by its own stress-inducible promoter ) , as well as the protein , was detectable in the leaves under simulated salinity stress ( 250 mM NaCl , 24 h ) ; the expression level being higher than wild type ( WT ) plants .
The Rab16A transcript also increased gradually with seed maturity , with its maximal accumulation at 30 d after pollination ( DAP ) ie , fully matured seeds , explaining the protective role of Rab16A gene during seed maturation .
Enhanced tolerance to salinity was observed in the plants transformed with Rab16A .
The superior physiological performances of the transgenics under salt treatment were also reflected in lesser shoot or root length inhibition , reduced chlorophyll damages , lesser accumulation of Na ( + ) and reduced loss of K ( + ) , increased proline content as compared with the WT plants .
All these results indicated that the overproduction of RAB16A protein in the transgenics enable them to display enhanced tolerance to salinity stress with improved physiological traits .
Our work demonstrates the profound potential of Group 2 LEA proteins ( to which RAB16A belongs to ) in conferring stress tolerance in crop plants through their genetic manipulation .
| Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: Overexpression of Rab16A gene in indica rice variety for generating enhanced salt tolerance .
| | Supplemental links/files: reference in endnote online text related articles pubmed citation | |
