About Textpresso Categories/Ontology Copyright Downloads Feedback Home Query Language Search User Guide
Enter keyword(s) and/or category/ies. Selecting categories for a query makes a search more specific. For example, you can retrieve sentences that contain the word HSN and a Oryza sativa gene name by typing the keyword 'SPW1' and choosing the category 'gene (Oryza sativa)'. A category hit occurs when a particular word or phrase in the sentence is defined as a member of a particular category. Categories will be concatenated by a Boolean 'and' operation to other categories and keyword(s) if present. To search for terms in categories, click on the Categories/Ontology link above.
Keywords
Separate multiple, required keywords by white spaces (Boolean 'and').
Separate multiple, alternative keywords by a comma with no white spaces (Boolean 'or').
Enter phrases in double quotes, and put a '-' sign in front of words which are to be excluded.
Keyword Specification
AND/OR
Categories
Fields
Search Scope
Search Mode
Sort by
 
Narrow your search results with filter:
Put a '+' sign in front of words which have to be included, a '-' sign in front of words which have to be excluded. Enter the field of the word, viz author, title, year, journal, abstract, type or sentence in square brackets. Enter phrases in double quotes.
For example, to find all the papers in the search result that have Jack as author, but not John, enter +Jack-John[author]. To exclude all papers that have the phrase double mutant in title, enter -"double mutant"[title]. You can combine several filters and enter something like +Jack-John[author] -"double mutant"[title] +1994[year] -review[type].
Click on Filter! button to activate the filter.

Goto:
of 2
Display options:
author: on | off accession: on | off type: on | off abstract: on | off title: on | off
citation: on | off journal: on | off year: on | off supplementals: on | off textlinks: on | off
searchterm-highlighting: on | off matching sentences: none 1 5 10 entries/page: 5 10 20 50
29 matches found in 16 documents. Search time: 0.087 seconds.
Global links/files: all results in endnote all results in print version
Score: 3.00
Title: Glucose modulates the abscisic acid-inducible Rab16A gene in cereal embryos .
Author: Toyofuku K Loreti E Vernieri P Alpi A Perata P Yamaguchi J
Citation: V : 42 ( 3 ) P : 451-60 Year: 2000 Type: ARTICLE
Literature: oryza Field: abstract Doc ID: pub10798615 Accession (PMID): 10798615
Abstract: Glucose effects on the expression of the abscisic acid-inducible Rab16A gene were examined in rice and barley embryos . Glucose feeding to rice embryos negatively affects the endogenous abscisic acid content and represses the promoter activity of the Rab16A gene . Glucose repression of the Rab16A gene takes place both at a transcriptional and a post-transcriptional level . Modulation of the abscisic acid content in rice embryos triggered by glucose did not directly influence the expression of the rice alpha-amylase gene RAmy3D , which is known to be under glucose control . The possible interaction between the glucose and abscisic acid signaling pathway is discussed .
Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: Glucose effects on the expression of the abscisic acid-inducible Rab16A gene were examined in rice and barley embryos .
[ Sen. 2, subscore: 1.00 ]: Glucose feeding to rice embryos negatively affects the endogenous abscisic acid content and represses the promoter activity of the Rab16A gene .
[ Sen. 3, subscore: 1.00 ]: Glucose repression of the Rab16A gene takes place both at a transcriptional and a post-transcriptional level .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: A Ca ( 2+ ) -dependent protein kinase that endows rice plants with cold and salt-stress tolerance functions in vascular bundles .
Author: Saijo Y Kinoshita N Ishiyama K Hata S Kyozuka J Hayakawa T Nakamura T Shimamoto K Yamaya T Izui K
Citation: V : 42 ( 11 ) P : 1228-33 Year: 2001 Type: ARTICLE
Literature: oryza Field: abstract Doc ID: pub11726707 Accession (PMID): 11726707
Abstract: A rice Ca ( 2+ ) -dependent protein kinase , OsCDPK7 , is a positive regulator commonly involved in the tolerance to cold and salt/drought . We carried out in situ detection of the transcript and immunolocalization of the protein . In the wild-type rice plants under both stress conditions , OsCDPK7 was expressed predominantly in vascular it issues of crowns and roots , vascular bundles and central cylinder , respectively , where water stress occurs most severely . This enzyme was also expressed in the peripheral cylinder of crown vascular bundles and root sclerenchyma . Similar localization patterns with stronger signals were observed in stress-tolerant OsCDPK7 over-expressing transformants with the cauliflower mosaic virus 35S promoter . The transcript of a putative target gene of the OsCDPK7 signaling pathway , rab16A , was also detected essentially in the same it issues upon salt stress , suggesting that the OsCDPK7 pathway operates predominantly in these regions . We propose that the use of the 35S promoter fortuitously strengthened the localized expression of OsCDPK7 , resulting in enhancement of the stress signaling in the inherently operating regions leading to improved stress tolerance .
Matching Sentences:
[ Sen. 6, subscore: 1.00 ]: The transcript of a putative target gene of the OsCDPK7 signaling pathway , rab16A , was also detected essentially in the same it issues upon salt stress , suggesting that the OsCDPK7 pathway operates predominantly in these regions .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: The slender rice mutant , with constitutively activated gibberellin signal transduction , has enhanced capacity for abscisic acid level .
Author: Ikeda A Sonoda Y Vernieri P Perata P Hirochika H Yamaguchi J
Citation: V : 43 ( 9 ) P : 974-9 Year: 2002 Type: ARTICLE
Literature: oryza Field: abstract Doc ID: pub12354914 Accession (PMID): 12354914
Abstract: The slender rice ( slr1-1 ) mutant , carrying a lethal and recessive single mutation , has a constitutive gibberellin ( GA ) -response phenotype and behaves as if it were saturated with GAs [ Ikeda et al ( 2001 ) Plant Cell 13 , 999 ] . The SLR1 gene , with sequence homology to members of the plant-specific GRAS gene family , is a mediator of the GA signal transduction process . In the slender rice , GA-inducible alpha-amylase was produced from the aleurone layer without applying GA . GA-independent alpha-amylase production in the mutant was inhibited by applying abscisic acid ( ABA ) . Shoot elongation in the mutant was also suppressed by ABA , indicating that the slender rice responds normally to ABA . Interestingly , shoot ABA content was 10-fold higher in the mutant than in the wild type , while there was no difference in root ABA content . Expression of the Rab16A gene , which is known to be ABA inducible , was about 10-fold higher in shoots of the mutant than in those of the wild type . These results indicate that constitutive activation of the GA signal transduction pathway by the slr1-1 mutation promotes the endogenous ABA level .
Matching Sentences:
[ Sen. 7, subscore: 1.00 ]: Expression of the Rab16A gene , which is known to be ABA inducible , was about 10-fold higher in shoots of the mutant than in those of the wild type .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: Expression of a calcineurin gene improves salt stress tolerance in transgenic rice .
Author: Ma X Qian Q Zhu D
Citation: V : 58 ( 4 ) P : 483-95 Year: 2005 Type: ARTICLE
Literature: oryza Field: abstract Doc ID: pub16021334 Accession (PMID): 16021334
Abstract: Calcineurin is a Ca2+- and calmodulin-dependent serine/threonine phosphatase and has multiple functions in animal cells including regulating ionic homeostasis . We generated transgenic rice plants that not only expressed a truncated form of the catalytic subunit of mouse calcineurin , but also were able to grow and fertilize normally in the field . Notably , the expression of the mouse calcineurin gene in rice resulted in its higher salt stress tolerance than the non-transgenic rice . Physiological studies have indicated that the root growth of transgenic plants was less inhibited than the shoot growth , and that less Na+ was accumulated in the roots of transgenic plants after a prolonged period of salt stress . These findings imply that the heterologous calcineurin plays a significant role in maintaining ionic homeostasis and the integrity of plant roots when exposed to salt . In addition , the calcineurin gene expression in the stems of transgenic plants correlated with the increased expression of the Rab16A gene that encodes a group 2-type late-embryogenesis-abundant ( LEA ) protein . Altogether our findings provide the first genetic and physiological evidence that expression of the mouse calcineurin protein functionally improves the salt stress tolerance of rice partly by limiting Na+ accumulation in the roots .
Matching Sentences:
[ Sen. 6, subscore: 1.00 ]: In addition , the calcineurin gene expression in the stems of transgenic plants correlated with the increased expression of the Rab16A gene that encodes a group 2-type late-embryogenesis-abundant ( LEA ) protein .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: An ABRE-binding factor , OSBZ8 , is highly expressed in salt tolerant cultivars than in salt sensitive cultivars of indica rice .
Author: Mukherjee K Choudhury AR Gupta B Gupta S Sengupta DN .
Citation: V : 6 ( ) P : 18 Year: Type: ARTICLE
Literature: oryza Field: abstract Doc ID: pub16939657 Accession (PMID): 16939657
Abstract: BACKGROUND : The bZIP class Abscisic acid Responsive Element ( ABRE ) -binding factor , OSBZ8 ( 38 . 5 kD ) has been considered to regulate ABA-mediated transcription in the suspension cultured cells of japonica rice . Still , nothing is known about the expression of OSBZ8 at protein level in vegetative it issue of salt sensitive and salt tolerant rice plants . In our previous study , Electrophoretic Mobility Shift Assay ( EMSA ) of [ 32P ] ABRE-DNA and nuclear extracts prepared from the lamina of Pokkali rice plants has detected the presence of an ABRE-binding factor . Northern analysis has also detected salinity stress induced accumulation of transcripts for bZIP class of factor . Therefore , OSBZ8 was considered to play an important role in the regulation of transcription in the vegetative it issue of rice . The aim of this study is to find out whether OSBZ8 has any role in regulating the NaCl-stress induced gene expression in vegetative it issue and whether the expression of OSBZ8 factor directly correlates with the stress tolerance of different varieties of indica type rice . RESULTS : Northern analysis of total RNA from roots and lamina of salt-sensitive M-I-48 and salt-tolerant Nonabokra , when probed with the N-terminal unique region of OSBZ8 ( OSBZ8p , without the highly conserved basic region ) , a transcript of 1 . 3 kb hybridized and its level was much higher in tolerant cultivar . EMSA with Em1a , the strongest ABA Responsive Element till reported from the upstream of EmBP1 , and the nuclear extracts from laminar it issue of untreated and salt-treated seedlings of three salt sensitive , one moderately sensitive and two salt tolerant indica rice cultivars showed specific binding of nuclear factor to ABRE element . Intensity of binding was low and inducible in salt sensitive rice cultivars while high and constitutive in salt tolerant cultivars . EMSA with 300 bp 5upstream region of Rab16A gene , a well known salt stress and ABA-inducible gene of rice , showed formation of two complexes , again very weak in salt sensitive and strong in salt tolerant rice cultivar . CONCLUSION : The bZIP factor OSBZ8 was found to be present in the ABRE-DNA : protein complex as shown by the supershift of the complex by the purified antiserum raised against OSBZ8p . Treatment of the seedlings with NaCl was found to enhance the complex formation , suggesting the regulation of OSBZ8 gene at both transcriptional and post-translational steps . Comparative EMSA with different varieties of rice suggests a positive correlation with the expression pattern of OSBZ8 and salt tolerance in rice cultivars .
Matching Sentences:
[ Sen. 10, subscore: 1.00 ]: EMSA with 300 bp 5upstream region of Rab16A gene , a well known salt stress and ABA-inducible gene of rice , showed formation of two complexes , again very weak in salt sensitive and strong in salt tolerant rice cultivar .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 5.00
Title: Transgenic tobacco plants overexpressing the heterologous lea gene Rab16A from rice during high salt and water deficit display enhanced tolerance to salinity stress .
Author: RoyChoudhury A Roy C Sengupta DN
Citation: V : 26 P : 1839-59 Year: 2007 Type: MEDLINE
Literature: oryza Field: abstract Doc ID: pub17554543 Accession (PMID): 17554543
Abstract: The full length Rab16A , from the indica rice Pokkali , was introduced into tobacco by Agrobacterium-mediated transformation . The transgene was stably integrated into the genome and they originated from different lines of integration . Expression of Rab16A transcript driven by its own promoter ( stress inducible ) in T2 progenies , only when triggered by salinity/ABA/PEG ( Polyethylene glycol ) -mediated dehydration , but not at the constitutive level , led to the stress-induced accumulation of RAB16A protein in the leaves of transgenic plants . The selected independent transgenic lines showed normal growth , morphology and seed production as the WT plants without any yield penalty under stress conditions . They exhibited significantly increased tolerance to salinity , sustained growth rates under stress conditions ; with concomitant increased osmolyte production like reducing sugars , proline and higher polyamines . They also showed delayed development of damage symptoms with better antioxidative machinery and more favorable mineral balance , as reflected by reduced H2O2 levels and lipid peroxidation , lesser chlorophyll loss as well as lesser accumulation of Na+ and greater accumulation of K+ in 200 mM NaCl . These findings establish the potential role of Rab16A gene in conferring salt tolerance without affecting growth and yield , as well as pointing to the fact that the upstream region of Rab16A behaves as an efficient stress-inducible promoter . Our result also suggests the considerable potential of Group 2 lea genes as molecular tools for genetic engineering of plants towards stress tolerance .
Matching Sentences:
[ Sen. 3, subscore: 2.00 ]: Expression of Rab16A transcript driven by its own promoter ( stress inducible ) in T2 progenies , only when triggered by salinity/ABA/PEG ( Polyethylene glycol ) -mediated dehydration , but not at the constitutive level , led to the stress-induced accumulation of RAB16A protein in the leaves of transgenic plants .
[ Sen. 7, subscore: 2.00 ]: These findings establish the potential role of Rab16A gene in conferring salt tolerance without affecting growth and yield , as well as pointing to the fact that the upstream region of Rab16A behaves as an efficient stress-inducible promoter .
[ Sen. 1, subscore: 1.00 ]: The full length Rab16A , from the indica rice Pokkali , was introduced into tobacco by Agrobacterium-mediated transformation .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: Trans-acting factor designated OSBZ8 interacts with both typical abscisic acid responsive elements as well as abscisic acid responsive element-like sequences in the vegetative it issues of indica rice cultivars .
Author: Roychoudhury A Gupta B Sengupta DN
Citation: V : 27 P : 779-94 Year: 2008 Type: MEDLINE
Literature: oryza Field: abstract Doc ID: pub18183401 Accession (PMID): 18183401
Abstract: Specific cis-acting elements , identified in the stress-regulated promoters , can respond to the changes in the levels of abscisic acid . Most of our previous works were done with ACGT-containing typical abscisic acid responsive elements ( ABREs ) but not with non-ACGT , GC-rich sequences also present in such promoters . The current communication shows a comparative analysis performed on the binding of rice nuclear proteins , together with the purified transcription factor OSBZ8 , to the cis-elements in the promoters of Rab16A ( Motif I/Motif II ) , Osem ( Motif A-1/Motif B ) and Em ( 4X ABRE/2X ABRC ) . Our data show that the extent of binding of nuclear protein from salt-tolerant rice to both typical ABREs and non-ACGT , ABRE-like sequences such as Motif IIa , is much higher than that from salt-sensitive rice and occurs constitutively , ie , even with the protein from unstressed plants . The complex formation is low and inducible only by salt in the salt-sensitive variety . While Motif I bind to a single 38 kDa protein , Motif IIa bind to two polypeptides of 38 and 29 kDa . We also show here that the activation and binding of OSBZ8 to the upstream regions of salt-inducible genes depends on its phosphorylated state . The novelty of our work is that it shows rice OSBZ8 as the prime factor interacting with both typical ABRE ( s ) and ABRE-like sequences . To our knowledge , this is also the first report for the detection and identification of Motif IIa ( non-ACGT , coupling element-like ) -binding factor ( s ) from rice and their expression pattern in different rice cultivars .
Matching Sentences:
[ Sen. 3, subscore: 1.00 ]: The current communication shows a comparative analysis performed on the binding of rice nuclear proteins , together with the purified transcription factor OSBZ8 , to the cis-elements in the promoters of Rab16A ( Motif I/Motif II ) , Osem ( Motif A-1/Motif B ) and Em ( 4X ABRE/2X ABRC ) .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid .
Author: Skriver K Olsen FL Rogers JC Mundy J
Citation: V : 88 ( 16 ) P : 7266-70 Year: 1991 Type: ARTICLE
Literature: oryza Field: abstract Doc ID: pub1831269 Accession (PMID): 1831269
Abstract: We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid ( ABA ) -responsive rice gene Rab16A and of the gibberellin A3 ( GA3 ) -responsive barley alpha-amylase gene Amy 1/6-4 . Our approach used transcriptional fusions between their 5 upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene . A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene . Transcription from this ABA response element ( GTACGTGGCGC ) was unaffected by GA3 . A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene . Transcription from this GA3 response element ( GGCCGATAACAAACTCCGGCC ) was repressed by ABA . The effect on transcription from both hormone response elements was orientation-independent , indicating that they function as inducible enhancers in their native genes .
Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid ( ABA ) -responsive rice gene Rab16A and of the gibberellin A3 ( GA3 ) -responsive barley alpha-amylase gene Amy 1/6-4 .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 3.00
Title: Comparative functional analysis of three abiotic stress-inducible promoters in transgenic rice .
Author: Rai M He C Wu R
Citation: V : P : Year: 2009 Type: Publisher
Literature: oryza Field: abstract Doc ID: pub19357984 Accession (PMID): 19357984
Abstract: To identify minimal effective promoters for driving abiotic stress-inducible transgene expression in rice , we selected promoter elements of three stress-responsive genes , viz . rab16A coding for dehydrin , OsABA2 coding for zeaxanthin epoxidase , and a gene coding for a hypothetical protein ( HP1 ) based on the presence of ABA- , salt and drought-responsive cis-acting elements . These were translationally fused to the gusA reporter gene and introduced into rice to study their effect on heterologous gene expression . The OsABA2 promoter was found to be the most effective and desirable promoter among the three in terms of driving a low constitutive transgene expression under normal conditions and high induction in response to ABA , salt and drought stress , the highest being a 12-fold induction in response to ABA . The rab16A and HP1 promoters resulted in high levels of constitutive expression . While induction of GUS activity was generally two to threefold for all the treatments in roots for both the promoters , induction in leaves was generally insignificant , the exceptions being rab16A in response to continuous salt stress and HP1 in response to water deficit . It was also observed that the three promoters , in general , resulted in lower constitutive expression , but higher induction in roots as compared to leaves .
Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: To identify minimal effective promoters for driving abiotic stress-inducible transgene expression in rice , we selected promoter elements of three stress-responsive genes , viz . rab16A coding for dehydrin , OsABA2 coding for zeaxanthin epoxidase , and a gene coding for a hypothetical protein ( HP1 ) based on the presence of ABA- , salt and drought-responsive cis-acting elements .
[ Sen. 4, subscore: 1.00 ]: The rab16A and HP1 promoters resulted in high levels of constitutive expression .
[ Sen. 5, subscore: 1.00 ]: While induction of GUS activity was generally two to threefold for all the treatments in roots for both the promoters , induction in leaves was generally insignificant , the exceptions being rab16A in response to continuous salt stress and HP1 in response to water deficit .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Score: 1.00
Title: Inducibility of three salinity/abscisic acid-regulated promoters in transgenic rice with gusA reporter gene .
Author: Ganguly M Roychoudhury A Sarkar SN Sengupta DN Datta SK Datta K
Citation: V : 30 P : 1617-25 Year: 2011 Type: MEDLINE
Literature: oryza Field: abstract Doc ID: pub21538101 Accession (PMID): 21538101
Abstract: The present study evaluates the pattern of stress inducibility of one natural promoter ( from rice Rab16A ) and two synthetically designed promoters , viz . , 4X ABRE ( abscisic acid-responsive element , having four tandem repeats of ABRE ) and 2X ABRC ( abscisic acid-responsive complex , having two tandem repeats of ABRE and two copies of coupling elements ) , in response to varying concentrations of NaCl and abscisic acid ( ABA ) . Each promoter , independently linked to gusA ( that encodes beta glucuronidase , GUS ) , was introduced into rice ( cv . Khitish ) through particle bombardment . The T ( 2 ) progenies showed integration of gusA in their genome . The accumulation of gusA transcript , driven by each promoter in T ( 2 ) transgenics , increased with increasing salt/ABA concentration , with ABA being the better activator of each promoter . Induction in GUS expression , driven by different promoters , was noted on exogenous salt/ABA treatments in a concentration-dependent manner . The maximum induction was observed with 2X ABRC promoter . All the three promoters could drive stress-inducible GUS expression in both vegetative and floral organs . However , prominent GUS expression was noted in the whole seed ( both embryo and aleurone layer of endosperm ) only by 2X ABRC , whereas it was localized only in the embryo for the other two promoters . Thus , our observation characterizes three efficient salinity/ABA-inducible promoters that have the potentiality in crop biotechnology to drive transgene expression for stress tolerance , whenever abiotic stress is encountered .
Matching Sentences:
[ Sen. 1, subscore: 1.00 ]: The present study evaluates the pattern of stress inducibility of one natural promoter ( from rice Rab16A ) and two synthetically designed promoters , viz . , 4X ABRE ( abscisic acid-responsive element , having four tandem repeats of ABRE ) and 2X ABRC ( abscisic acid-responsive complex , having two tandem repeats of ABRE and two copies of coupling elements ) , in response to varying concentrations of NaCl and abscisic acid ( ABA ) .
Supplemental links/files: reference in endnote online text related articles pubmed citation
Goto:

© Textpresso Sat May 25 02:01:55 2024 .